[HTML payload içeriği buraya]
28.7 C
Jakarta
Friday, July 31, 2026

Virus-like buildings for mixture antigen protein mRNA vaccination


Ethics assertion

4- to five-week-old K18-hACE2 C57BL/6 mice (human ACE2 gene knock-in C57BL/6 mice) by Cyagen Biosciences (animal license quantity SCXK (Su) 2022-0016). BALB/c mice and seven- to eight-week-old golden hamsters have been bought from Very important River (animal license numbers SCXK (Jing) 2021-0006 and SCXK (Jing) 2021-0011). All animals have been bred in particular pathogen-fee barrier services (laboratory license quantity SYXK (Lu) 2020-0019). The laboratory animals have been cared for and used following the ‘3 Rs’ precept and animal welfare tips. The animal experiment course of and animal-related care and welfare have been reviewed and permitted by the Animal Experiment Ethics Committee of Shandong WeigaoLitong Organic Merchandise (approval quantity LACUC-RD3-2022-006).

Cell traces

HEK-293T and 16HBE cells have been cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; HyClone, GE Healthcare), 10% 100 U ml−1 penicillin and 100 mg ml−1 streptomycin. JASWII dendritic cells have been cultured in MEM Alpha (Thermo Fisher Scientific) supplemented with 20% FBS and 5 ng ml−1 murine granulocyte–macrophage colony-stimulating issue (HY-P7361, MCE). RAW264.7 cells have been cultured in minimal Eagle’s medium (MEM; Thermo Fisher Scientific) supplemented with 10% FBS. THP-1 cells have been cultured in RPMI 1640 (Thermo Fisher Scientific) supplemented with 10% FBS and 0.05 mM β-mercaptoethanol (M917637, Macklin). All cells have been bought from ATCC and maintained at 37 °C with 5% CO2.

Virus

The novel coronavirus H pressure (Omicron BA.5) was remoted from COVID-19 sufferers in December 2022. The whole genome sequence was uploaded to NCBI GenBank (OQ179919.1). The novel coronavirus KMS-2 pressure (Wuhan) was remoted from COVID-19 sufferers on the Hospital for Infectious Ailments in Yunnan Province in February 2020.

Animal experimental design

C57BL/6-ACE2 (BALB/c or golden hamster) mice have been randomly divided into 5 teams (Supplementary Fig. 7).

In group A (immune experimental group, n = 35), C57BL/6-hACE2 mice have been divided into 4 teams: management, VLS, mRNA and peptide. The VLS contained 20 μg of mRNA and 10 μg of protein; the mice within the mRNA group have been immunized with 20 μg of mRNA, and the mice within the peptide group have been immunized with 10 μg of protein. All of the mice underwent booster immunization on the twenty first day after main immunization. At 24, 48 and 72 h after main immunization, tissues from the immune web site have been obtained for immunofluorescence detection for qRT–PCR measurement of cytokine expression. Furthermore, B, CD4+ T and CD8+ T cells have been sorted from lymph nodes at 3, 7 and 14 days after main immunization and 28 days after booster immunization for transcriptome sequencing.

In group B (immune experimental group, n = 36), C57BL/6-hACE2 mice have been divided into three teams: the management, VLS and mRNA teams. The mRNA used for the VLS and mRNA vaccines to discover the tissue web site of mRNA molecules with the supply system. The center, liver, spleen, kidneys, lungs, mind and lymph nodes have been collected at 1, 3, 5 and seven days after i.m. injection for tissue immunofluorescence detection.

In group C (immune experimental group, n = 72), BALB/c mice have been divided into 12 teams: N1–N12. N1–N4 have been the mRNA vaccine teams, N5–N8 have been the VLS vaccine teams and N9–N12 have been the peptide vaccine teams. N1–N4 contained 5, 10, 20 and 40 μg mRNA, respectively. N5–N8 contained 5 μg mRNA and 5 μg peptide, 10 μg mRNA and 5 μg peptide, 10 μg mRNA and 10 μg peptide, and 20 μg mRNA and 10 μg peptide, respectively. N9–N12 contained 5 μg, 10 μg, 20 μg and 30 μg of peptide, respectively. All of the mice underwent booster immunization on the twenty first day after main immunization. Blood samples have been collected from the tail vein on days 35, 49, 120, 180 and 240 after immunization for antibody detection. At 28 days after booster immunization, blood was collected for neutralizing antibody and binding antibody testing, and the spleen was subjected to lymphocyte separation and ELISpot assays. On the identical time, the immune titre of the SARS-CoV-2 vaccine was in contrast.

In group D (immunoprotective experimental group; C57BL/6-hACE2, n = 75; golden hamster, n = 40), at 28 days after booster immunization, the mice within the management, VLS, mRNA and peptide teams have been challenged with SARS-CoV-2 Omicron BA.5 (104.5 50% cell tradition infectious dose (CCID50)), SARS-CoV-2 wild-type (104 CCID50) or SARS-CoV-2 Omicron XBB.1 (104.5 CCID50) through the intranasal route. The center, liver, spleen, kidneys, lungs, trachea, mind, spinal twine, lymph nodes and intercourse organs have been collected at 3, 5 and seven days after viral an infection for viral load quantification. In the meantime, B, CD4+ T and CD8+ T cells have been sorted from C57BL/6-hACE2 mouse lymph nodes at 3 days after problem for transcriptome sequencing.

In group E (transfusion experiment, n = 27), DCs have been handled with LNPs-peptide, LNPs-mRNA and VLSs for 12 h. The in vitro-treated DCs (3 × 105 cells per mouse) have been transfused into mice via the tail vein. The spleen and inguinal lymph nodes have been obtained at 3 and 5 days after adoptive switch for stream cytometry and qRT‒PCR. Antibody titres have been measured 21 days after transfusion. The above animal problem experiments have been commissioned by Wuhan Institute of Organic Merchandise.

Synthesis and formulation of the LNP supply system

Based on the molecular weights of ((2-(2-hydroxyethoxyl)ethyl)azanddiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate), 1,2-dioleoyl-3-trimethylammonium propane, 1,2-dierucoyl-phosphatidylcholine and methoxypoly(ethylene glycol)-N-tetradecyltetradecanamide-1-2k, these have been dissolved in absolute ethanol (Grade of assured reagent) to molecular concentrations of 20%, 10%, 20% and 10%, respectively. All 4 parts have been blended at a molar ratio of 30.68:6.84:15.2:1 in ethanol to arrange the LNP supply system. The mRNA was diluted in accordance with the requested ratio in buffer of 20 mM sodium acetate, 2.5 mM KCl and 0.1% trehalose. The LNP–mRNA was ready with NanoAssemblr Ignite+ LNPs (Precision Nanosystems) by mixing clean LNPs with mRNA at a weight ratio of 1:3. The lipid particles have been additional characterised by Zetasizer Extremely spectrometry.

Synthesis of SARS-CoV-2 S1 mRNA

The S1 sequence of SARS-CoV-2 was amplified and inserted into the PVAX vector by PCR expertise. The 5′-untranslated area (UTR) of yellow fever virus was amplified and inserted earlier than the Kozak sequence and the three′-UTR of the human mitochondrial ribosome was amplified and inserted after the S1 sequence because the 5′-UTR and three′-UTR of the S1 sequence. The constructed plasmid was linearized with BamHI (catalogue quantity R0136V, NEB) at 37 °C for 3 h for the in vitro transcription response. N1mψ-modified S1 mRNA was synthesized via an in vitro transcription response (HiScribe T7 ARCA mRNA Equipment, catalogue quantity E2060S, NEB). The response combination was handled with DNase I and purified utilizing lithium chloride precipitation.

Preparation of the VLS vaccine

The VLS vaccine was ready by including LNP–mRNA and peptide to the buffer (0.1% trehalose and three.5% glucose) and mixing at room temperature for 30 min at 30 r.p.m. earlier than rotating the combination at 10 r.p.m. at 4 °C in a single day. The VLS vaccine was additional characterised by Zetasizer Extremely spectrometry.

LNP mRNA- and VLS-transfected cells

Then, 0.5, 1, 2, 5 and 10 μg of mRNA was transfected into 293T cells with the LNP supply system, and western blot detection was carried out at 24 h after transfection. In the meantime, the mRNA and VLSs have been transfected into 16HBE, JASWII DCs, THP-1 cells and RAW264.7 cells for Western blot evaluation and qRT‒PCR measurement at 24 h.

Co-immunoprecipitation

Anti-S1 and anti-N antibodies have been added to the LNP-encapsulated mRNA and VLS vaccine (the VLS vaccines have been loaded with BA.1 S1 protein or N protein). Then, 50 μl of magnetic beads (BeaverBeads Protein A Matrix Antibody Purification Equipment, catalogue quantity 20102, Suzhou) have been added and incubated for 30 min at room temperature at 30 r.p.m. Subsequent, the samples with magnetic beads have been adsorbed at room temperature for two–3 min on the magnetic pole, and the supernatant was used for mRNA and protein content material measurement. Then, washing buffer was used to scrub the beads, and elution buffer was added for elution and measurement of mRNA by qRT‒PCR and protein content material by ELISA.

qRT–PCR

The quantity of mRNA within the VLS and mRNA vaccines was measured by qRT‒PCR. Based mostly on the rules, the binding web site designed for the primer was positioned within the SARS-CoV-2 S1 gene area, and a part of the S1 gene was constructed within the pUC57 plasmid. In vitro-transcribed mRNA was used as a normal pattern. The primers have been F: TGGATCTGGAGGGAAAGCAGGGCAACT and R: CCGATTGGCAGATCCACCAGAGGTTC, and the TaqMan probe (Sangon Biotech) had the sequence 5′-6FAM-ATGGCTACTTCAAGATCTATAGCAAGC-TAMRA-3′.

The viral hundreds within the tissues have been decided by qPCR with absolute quantification. Based mostly on World Well being Group tips, the binding web site designed for the primer was positioned within the SARS-CoV-2 N gene area, and the N gene was constructed on the pUC57 plasmid. The primers have been F: GAATGGCTGGCAATGGCGGTGATGCT and R: TTGTTGGCCTTTACCAGACATTTTGCT, and the TaqMan probe (Sangon Biotech) had the sequence 5′-6FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Viral genomic RNA was extracted from tissues utilizing RNAiso Plus (T9108, Takara), and the reactions have been carried out utilizing a One Step PrimeScript RT‒PCR Equipment (Excellent Actual Time) (TaKaRa, code RR064A).

For the relative expression of cytokines in tissues and cells, complete RNA was extracted with RNAiso Plus (T9108, Takara). Gene expression was expressed because the fold change (2−∆∆Ct) relative to the degrees in samples from LNP-injected mice or virus-uninfected cells, which have been used for calibration. The reactions have been carried out through the use of a One-Step SYBR PrimeScript PLUS RT–PCR Equipment (TakaRa, code RR096A). The precise primers used are listed in Prolonged Information Tables 4 and 5.

Immunofluorescence and confocal microscopy

Muscle tissues have been collected and instantly frozen in liquid nitrogen. The tissue sections have been embedded in OCT (Tissue-Tek OCT Compound 4583, Sakura) and sliced on a cryostat to a thickness of 5 µm (CM1850, Leica). Tissue sections have been fastened and blocked with 5% BSA. For detection of the viral antigen, the sections have been sequentially incubated with a main mouse anti-SARS-CoV-2 S antibody (Sino Organic, catalogue quantity 40150-V08B1) and an Alexa Fluor 647-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). DCs have been detected utilizing an anti-CD11c antibody (Abcam, catalogue quantity ab33483-N418), and macrophages have been detected utilizing an anti-F4/80 antibody (Zhengneng, catalogue quantity 263101-31B1), an Alexa Fluor 488-conjugated goat anti-rabbit IgG secondary antibody and a 647-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). All cell nuclei have been detected utilizing 4,6-diamidino-2-phenylindole and analysed utilizing a confocal microscope (TCS SP2, Leica).

Virus titration

The virus titre was decided with a plaque assay in accordance with normal protocols, as described beforehand28. In short, the virus was subjected to gradient dilution and added to six-well plates. Carboxymethylcellulose was used because the matrix in a liquid overlay, crystal violet was used because the stain to boost plaque visualization, and the cells have been cultured at 37 °C with 5% CO2 for 7 days.

Neutralization assay

Briefly, serum was inactivated for 30 min at 56 °C, repeatedly diluted from 1:4 and blended with virus at a titre of 100 occasions the CCID50/100 μl and incubated at 37 °C for two h. The combination was added to a six-well plate and used carboxymethylcelluloseas the matrix, and crystal violet was used because the stain to boost plaque visualization after tradition at 37 °C with 5% CO2. In the meantime, the serum neutralization titres of pseudoviruses have been measured, and the 50% inhibitory dilution (EC50) was outlined because the serum dilution at which the relative gentle models have been diminished by 50% in contrast with these of the virus management wells (virus + cells) after subtraction of the background relative gentle models within the management teams with cells solely. In short, pseudovirus (Acro, catalogue quantity PSSO-HLC016) was incubated with serial dilutions of the check samples repeatedly diluted from 1:64 in duplicate for 1 h at 37 °C, along with the virus management and cell management wells. Then, 293T-ACE2 cells have been added to every nicely. Following 48 h of incubation in a 5% CO2 surroundings at 37 °C, the luminescence was measured.

IFNγ-specific and IL-4-specific ELISpot assay

For the ELISpot assay, mouse IFNγ and IL-4 ELISpot kits (Mabtech) have been used in accordance with the producer’s protocol. Briefly, a plate was conditioned and seeded with splenic lymphocytes previous to the addition of three μg of stimulant (XBB Spike RBD Protein, catalogue quantity 40592-V08H144, Sino Organic; B.1.1.529 Spike RBD Protein, catalogue quantity SPD-C522e, Acro; BA.4/BA.5 Spike RBD Protein, catalogue quantity SPD-C522R, Acro; BA.2.12.1 Spike RBD Protein, catalogue quantity SPD-C522q, Acro; BQ.1.1 Spike RBD Protein, catalogue quantity SPD-C5240, Acro; BA.2.75.2 Spike RBD Protein, catalogue quantity SPD-C522z, Acro). Then, the cells have been added and incubated at 37 °C for 30 h. Subsequent, the cells and medium have been eliminated, and the plate was developed. The colored spots have been counted utilizing an ELISpot reader (Mabtech).

Isolation of B, CD4+ T and CD8a+ T cells from mouse lymph nodes

Lymph nodes have been remoted below sterile circumstances and gently floor, and lymphocytes have been separated right into a suspension.

B cells have been enriched with MajoSort Mouse CD19 Nanobeads (catalogue quantity SPD-C522R, Acro 480002, BioLegend), CD4+ T cells have been enriched with the EasySep Mouse CD4+ T-cell isolation equipment (catalogue quantity SPD-C522R, Acro 19852A, Stemcell), and CD8+ T cells have been enriched with the EasySep Mouse CD8a+ choice equipment (catalogue quantity SPD-C522R, Acro 18953, Stemcell).

Transcriptome evaluation of B, CD4+ T and CD8a+ T cells

The B, CD4+ T and CD8a+ T cells have been sorted by lymph nodes. Complete RNA was extracted utilizing TRIzol (catalogue quantity DP421, Tiangen). RNA amount and integrity have been evaluated utilizing a NanoDrop system and a Bioanalyzer, and the samples have been ready in accordance with Illumina’s directions and sequenced (Gene Denovo Biotechnology). Genes with 2-fold or higher adjustments in expression at P < 0.05 within the Kyoto Encyclopedia of Genes and Genomes analyses have been chosen and grouped into useful classes. All transcriptome sequencing outcomes have been uploaded to GSA; the assigned accession variety of the submission was CRA010542.

ELISA

The S1 antigen was quantified utilizing a SARS-CoV-2 Spike Protein ELISA Equipment (Acro, catalogue quantity RAS-A039), and the nucleoprotein was quantified utilizing a SARS-CoV-2 (2019-nCoV) Nucleoprotein ELISA Equipment (Jiya Biotechnology,). S1-RBD IgG assays have been carried out utilizing SARS-CoV-2 RBD (Wild-Sort) Antibody (IgG) Detection Kits (Vazyme, catalogue quantity DD3201-01), SARS-CoV-2 RBD (Omicron BA.4/5) Antibody (IgG) Detection Kits (Vazyme, catalogue quantity DD3214-01, China) and Mouse Anti-2019-nCoV (S) IgA Elisa Kits (FineTest, catalogue quantity 1906).

The S1 antibody assays have been carried out utilizing a Mouse Anti-SARS-CoV-2 (B.1.1.529) Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T061), Mouse Anti-SARS-CoV-2 Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T045), Mouse Anti-SARS-CoV-2 (B.1.351) Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T084), Mouse Anti-SARS-CoV-2 (B.1.617.2) Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T086). The antibody serum samples that yielded optical density values not less than 2.1-fold larger than that of the damaging management have been thought of optimistic. The endpoint titre was outlined as the best serum dilution that yielded a optimistic optical density worth. The geometric imply titre was calculated because the geometric imply of the endpoint titres of the optimistic serum samples in every group.

Western blotting

Proteins have been separated by 12% SDS–PAGE and transferred to polyvinylidene difluoride membranes. The membranes have been blocked with 5% bovine serum albumin–Tris-buffered saline with Tween-20 (Sigma-Aldrich) and incubated with an anti-SARS-CoV-2 S1 antibody (MHC0102, Yunnan Lepeng Expertise), anti-ACE2 antibody (Abcam, catalogue quantity ab15348), and anti-DC-SIGN antibody (Santa Cruz Biotechnology, catalogue quantity sc-74589) for two h; washed 3 times and incubated with HRP-conjugated goat anti-mouse IgG (H + L) (Sigma) for 1 h. Lastly, the polyvinylidene difluoride membranes have been washed 3 times and coated with ECL ultrasensitive chemiluminescence reagent (NCM Biotech, catalogue quantity P10100) and positioned in a Bio-Rad gel imager for publicity and color growth.

Silver staining with SDS‒PAGE

The ready SDS–PAGE gel was silver-stained with a equipment (Quick Silver Stain Equipment, catalogue quantity P0017S, Beyotime). Silver staining of the SDS‒PAGE gels was carried out in ten steps: fixation, washing with 30% ethanol, washing with water, sensitization, washing with water, silver staining, washing with water, color growth, termination and washing with water.

Circulate cytometry evaluation

Lymph nodes and spleens have been collected on days 3 and seven after main and booster immunization with the vaccine, and remoted lymphocyte. The flow-labelled antibodies used to detect the floor markers of DC activation have been PE/Cy5-CD45 (catalogue quantity MA5-38732, Thermo Fisher), PE/Cy7-CD11c (catalogue quantity A15849, Thermo Fisher), FITC-CD80 (catalogue quantity A14722, Thermo Fisher), APC-CD83 (catalogue quantity ab234119, Abcam), and PE-CD86 (catalogue quantity 12-0862-82, Thermo Fisher). The flow-labelled antibodies used to detect particular T-cell floor markers have been BV421-CD44 (catalogue quantity 103019, BioLegend), APC-CD25 (catalogue quantity 102011, BioLegend), PE/Cy5-CD3 (catalogue quantity 100205, BioLegend), FITC-CD4 (catalogue quantity 100405, BioLegend), APC/Cy7-CD8 (catalogue quantity 100713, BioLegend) and PE-Tetramer (Helixgen COVID-19 MHC-I Tetramer). The flow-labelled antibodies used to detect activated B-cell floor markers have been FITC-CD19 (catalogue quantity 115505, BioLegend), PerCp/Cy5.5-GL7 (catalogue quantity 144609, BioLegend) and PE-S1 (Expedeon, catalogue quantity 336-005). The cells have been stained for 30 min at 4 °C and washed twice previous to stream cytometric evaluation (LSR Fortessa, BD).

Luminex assays

The Bio-Plex Mouse 23-Plex Panel assay (catalogue quantity M60009RDPD) was carried out in accordance with the producer’s directions. Briefly, a normal curve starting from 1.6 to 10,000 pg ml−1 was generated by serial dilution of the reconstituted normal. The filter plates have been blocked by pipetting 200 µl of assay buffer into every nicely. After 10 min, the assay buffer was discarded by vacuum aspiration, and 25 µl of assay diluent was added to the wells designated for the samples, RPMI 1640 with GlutaMAX (Gibco) was added to the wells for the requirements. Then, normal or pattern was added to the suitable wells, and 25 µl of antibody-coated fluorescent beads was added. Biotinylated secondary and streptavidin–phycoerythrin-labelled antibodies have been subsequently added to the plate via alternating incubation and washing steps. Then, 100 µl of sheath fluid was added to the wells, and browse instantly with the Bio-Plex array reader at excessive and low RP1 targets utilizing a five-parameter logistic regression curve.

Statistical evaluation and reproducibility

For western blot and electron microscopy, immunofluorescence assays have been repeated not less than twice; for ELISA, quantitative evaluation was repeated not less than 3 times. All the information are expressed as imply values with s.e.m. Vital variations between teams have been analysed by GraphPad Prism. Statistical significance was set to P < 0.05.

Reporting abstract

Additional data on analysis design is on the market within the Nature Portfolio Reporting Abstract linked to this text.

Related Articles

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Latest Articles