[HTML payload içeriği buraya]
27.7 C
Jakarta
Friday, July 10, 2026

Evaluating the pro-survival potential of apoptotic our bodies derived from 2D- and 3D- cultured adipose stem cells in ischaemic flaps | Journal of Nanobiotechnology


Cells tradition

Mouse ADSCs (MUBMD-01001) have been obtained from Ori Cell Bio Co., Ltd. The mADSCs was cultured in mADSC full tradition medium (Ori Cell Bio, MUXMD-90,011). mADSCs have been cultivated at 37 °C in an incubator with 5% CO2 and 95% air. The research have been performed utilizing mADSCs in the course of the fourth passage.

Raw264.7 (CL-0190) and HUVECs (CL-0122) have been obtained from Procell Life Science & Know-how Co., Ltd. We cultured the cells in an incubator in 5% CO2 and 95% air at 37 °C. DMEM (Gibco, C11995500BT) supplemented with sterile 10% FBS (Gibco, 10,099,141 C) and 1% penicillin‒streptomycin (Gibco, 1,719,675) was used to tradition the cells.

Add the cell suspension (100 µl/effectively, 1000 cells/effectively) to the 96U-shaped effectively plate (Engineering For Life, EFL-SP101) of the cell pellet handled with the anti-adhesion coating resolution. Spherical 3D-mADSCs have been shaped after 48 h of tradition within the plate, and the following experiment was carried out. Optical microscope was used to watch the standing of 2D-mADSC and 3D-mADSC. The cytoskeleton was labeled with phalloidin-FITC (Actin-Tracker Inexperienced; Beyotime, C1033), and the nucleus was stained with DAPI (Abcam, ab228549). The Calcein/PI cell viability and cytotoxicity detection package (C2015S) have been employed, following the producer’s directions, to stain 2D- and 3D-mADSCs, for the aim of observing cell viability. And the cell morphology of 2D- and 3D-mADSCs was noticed below a confocal microscope.

Animals

The Wenzhou Medical College Animal Welfare and Use Committee authorized every animal take a look at that was carried out in accordance with the China Nationwide Institutes of Well being’s Pointers for the Welfare and Use of Lab Animals (wydw2024-0057). Male C57BL/6 mice (imply physique weight 20–30 g, 6–8 weeks) have been offered by the Wenzhou Medical College Experiment Animal Heart (no. SCXK [ZJ] 2015–0001). All mice have been saved below regular circumstances (21–25 °C, humidity: 50–60%, 12-h mild/darkish interval) and possessed free meals and drinks. Each mouse utilized on this analysis has a background in C57BL/6J.

Isolation and characterization of ABs

After being handled with 0.5 µmol/L STS (Med Chem Categorical, HY-15,141) for apoptosis induction, 2D or 3D-mADSCs have been incubated at 37 °C in 5% CO2. Cell supernatants have been collected after 12 h and centrifuged for five min at 300 × g to eradicate any remaining cell particles. After that, the supernatants have been centrifuged 3 times for 30 min at 2,000 × g. ABs derived from 2D or 3D-mADSCs have been then resuspended in PBS (Procell, PB180327) for additional use. To determine the protein composition of 2D or 3D-ABs, we employed the BCA protein assay. Make the most of a scanning electron microscope (SEM) to look at the morphology and estimate the scale vary of the remoted ABs. The correct dimension distribution of 2D or 3D-ABs (gated dimension with mouse platelets) was measured utilizing circulation cytometry. Western blotting (WB) experiments was performed to establish ABs utilizing floor marker proteins (H3(Protein Know-how Group, 17168-1-AP), H2B (ABclonal, A1958), C1QC (ABclonal, A9227) and C3B (ABclonal, A13283)). The WB experimental methodology used right here is as beforehand described in a referenced article [12]. β-Actin (Abcam, ab213262) was employed as a quantitative indicator in WB. In accordance with the producer’s directions, 2D- and 3D- ABs have been stained with the Annexin V-FITC/PI Cell Apoptosis Detection Equipment (Servicebio, G1511) to establish distinctive PS indicators on the ABs. FCM was employed to guage the purity of the ABs.

Internalization of ABs into HUVECs and Raw264.7 in vitro

After plating the HUVECs and Raw264.7 onto plates, they have been saved at 37 °C for the entire night time. 2D or 3D-ABs have been pre-labeled with the Cell Plasma Membrane Staining Equipment with DiI (Beyotime, C1991S) as directed by the producer and centrifuged 3 times at 2,000 × g for 30 min in PBS. DiI 2D or 3D-ABs have been then co-cultured with HUVECs for 12 h at a focus of 10 µg/ml. After the cell nuclei have been fastened for 15 min at 4 °C with 4% paraformaldehyde (Solarbio, P1110), they have been counterstained with Hoechst 33,342 (Biosharp Life sciences, BL803A). Cell morphology of HUVECs and Raw264.7 with DiI-ABs (2D and 3D) was noticed below a confocal microscope.

Hypoxic cell mannequin

Cells have been chosen from a wholesome logarithmic progress part, trypsined with 0.25% (Gibco, 25,200,072), adopted by centrifugation, supernatant elimination, resuspension, and subsequent seeding in cell tradition plates for the respective experiments. The normoxic group was cultured in a typical cell tradition incubator. The hypoxia group and drug administration group have been incubated in a humidified hypoxic chamber at 37 °C, with an environment (1% O2, 5% CO2, and 94% N2) for twenty-four h.

Cell counting package 8

HUVECs have been plated in 96-well plates at a density of 5 × 103 cells per effectively, leading to 50% cell confluence. The cells have been then uncovered to a wide range of therapies, together with PBS, 2D-ABs at completely different concentrations (starting from 0 to 70 µg/ml), and a ten µg/ml focus of 2D/3D-ABs. The cells have been co-incubated with gradient ABs concentrations in 96-well plates inside a hypoxic incubator. In distinction, NC group cells have been cultured in 96-well plates in a normoxic incubator, following the process outlined within the “Hypoxic cell mannequin”. Subsequently, 10 µL of CCK-8 resolution (Med Chem Categorical, HY-K0301) was launched to the wells, and the cells have been incubated at 37 °C for 3 h. A microplate reader was used to measure absorbance at 450 nm.

Tube formation assay

On ibidi µ-slides (Ibidi, 81,506) coated with 10 µL/effectively of progress factor-reduced Matrigel (Corning, 356,234), the in vitro angiogenic exercise of HUVECs was evaluated. HUVECs have been reseeded within the ready ibidi µ-slides after being stained for 30 min with the cell-permeable dye (calcein AM; Beyotime, C2012). Utilizing a confocal microscope, capillary-like tube improvement was seen throughout an 8-hour incubation interval at 37 °C in a cell tradition incubator. These constructions have been outlined as tubes with a size 4 occasions their width. Tube lengths have been quantified in duplicate wells, and the typical size was calculated utilizing ImageJ software program.

Transwell assay

Polycarbonate membrane Transwell inserts (8.0-µm) have been utilized in cell migration checks to guage the in vitro migratory means of HUVECs in every group (Corning, 3422). HUVECs have been positioned within the prime chambers and cultured at 37 °C for eight hours following the prescribed procedures. Subsequently, crystal violet staining and 4% paraformaldehyde fixation have been utilized to every chamber’s cells. A computerized microscope was used to take photos of the migrated cells.

Apoptosis detection

The Annexin V-FITC/PI Cell Apoptosis Detection Equipment was used to stain the HUVECs in every group in compliance with the rules given. The apoptosis ranges of HUVECs have been subsequently detected utilizing circulation cytometry.

Immunocytochemistry

HUVECs in every group have been subjected to fixation for 30 min with 4% paraformaldehyde. Subsequently, they underwent a 5-minute permeabilization step utilizing 0.1% Triton X-100 (Aladdin, T109027) in PBS, adopted by a 30-minute blocking process with 10% goat serum (Beyotime, C0265) in PBS. Intracellular ROS ranges in HUVECs have been assessed utilizing DHE (Dihydroethidium; Beyotime Biotechnology, S0063) following the producer’s protocol. Lifeless cell ranges in HUVECs have been decided via TUNEL (In Situ Cell Loss of life Detection Equipment, Fluorescein; Roche, 11,684,795,910) in keeping with the producer’s directions. JC-1 (Beyotime Biotechnology, C2003S) was used to measure the mitochondrial membrane potential in HUVECs as per the producer’s pointers.

Macrophage polarization assay

Raw264.7 cells from completely different stimulation teams have been trypsined, resuspended, and chilled at 4 °C, adopted by fixation in 70% alcohol for two h. After two resuspensions in PBS and adjustment to a focus of two × 106 cells per EP tube, antibodies have been developed within the cells: Arg1 (1:50; Cell signaling Know-how, 93,668 S) and iNOS (1:50; Cell signaling Know-how, 13,120 S) for 30 min. Subsequently, they have been resuspended twice in PBS, handled with secondary antibodies (goat anti-rabbit IgG – H&L DyLight® 488 (Abcam, ab96883); goat anti-mouse IgG – H&L DyLight® 594 (Abcam, ab96873)), after which washed twice with PBS previous to conducting circulation cytometry evaluation. qPCR.

Utilizing the mirVana miRNA Isolation Equipment (Ambion) and the producer’s directions, whole RNA was extracted. Whole RNA was quantified utilizing the Nanodrop 2000 (Thermo Fisher Scientific Inc., USA). The Agilent 2100 Bioanalyzer (Agilent Know-how, USA) was utilized to guage the integrity of RNA.

Quantitation was accomplished by way of a two-step response: reverse transcription (RT) and PCR. Each RT course of concerned 0.5 µg of RNA, 2 µL of 5 × TransScript All-in-One SuperMix for qPCR and 0.5 µL of gDNA Remover (10 µL). The response was carried out utilizing a GeneAmp® PCR System 9700 (Utilized Biosystems, USA) for 15 min at 42 °C after which for five s at 85 °C. Subsequently, the ten µL RT response combination was desaturated 10 occasions at -20 °C in nuclease-free water. Actual-time PCR was carried out utilizing a Mild Cycler® 480 II real-time PCR instrument (Roche, Switzerland) with 10 µL of PCR combine, 1 µL of cDNA, 5 µL of two × PerfectStart Inexperienced qPCR SuperMix (TransGen Biotech Co., AQ601), 0.2 µL of ahead primer, 0.2 µL of reverse primer and three.6 µL of nuclease-free water. The response was carried out in a 384-well optic plate for 0.5 min (Roche, 04729749001) at 94 °C after which for 45 cycles of 5 s at 94 °C and 30 s at 60 °C. The specimens have been analysed 3 times. After the PCR cycles have been full, a melting curve assay was used to confirm the manufacturing of the anticipated PCR merchandise. The next primer sequences have been synthesized by GeneChem utilizing the mRNA sequences acquired from the NCBI database: Tnf 5’- GATCGGTCCCCAAAGGGATG − 3’ (ahead) and 5’- CCACTTGGTGGTTTGTGAGTG − 3’ (reverse); Nos2 5’- TCTAGTGAAGCAAAGCCCAACA − 3’ (ahead) and 5’- CCTCACATACTGTGGACGGG − 3’ (reverse); Il6 5’- CCTTCTCCACAAGCGCCTTC − 3’ (ahead) and 5’- GGAAGGCAGCAGGCAACA − 3’ (reverse); Cd163 5’- GTGCTGGATCTCCTGGTTGT − 3’ (ahead) and 5’- CGTTAGTGACAGCAGAGGCA − 3’ (reverse); Arg1 5’- GTAGACCCTGGGGAACACTAT − 3’ (ahead) and 5’- ATCACCTTGCCAATCCCCAG − 3’ (reverse); Il10 5’- GCTGTCATCGATTTCTCCCCT − 3’ (ahead) and 5’- GACACCTTGGTCTTGGAGCTTAT − 3’ (reverse); Actb 5’- CTACCTCATGAAGATCCTCACCGA − 3’ (ahead) and 5’- TTCTCCTTAATGTCACGCACGATT − 3’ (reverse). We normalized the expression of the goal mRNAs to Actb mRNA expression, respectively. The two-ΔΔCt methodology was used for qPCR analyses.

Western blotting

Utilizing chilly RIPA lysis buffer (Beyotime, P0013B) enhanced with phenylmethanesulfonyl fluoride (PMSF; Beyotime, ST506) in addition to a protease and phosphatase inhibitor cocktail (Beyotime, P1046), Raw364.7 cell samples have been homogenized. To acquire cell lysate, the homogenates have been centrifuged at 20,000 g for 30 min at 4 °C. The Omni-EasyTM Instantaneous BCA Protein Assay Equipment was used to measure the protein concentrations.After loading 30 mcg of protein onto 4–22% SDS–PAGE gels, the protein was subsequently moved into PVDF membranes (Millipore). When main antibodies have been utilized, the PVDF membranes had been diluted utilizing 5% skim milk (BD Biosciences, 232,100) and incubated at 4 °C for 15 h. The membranes adopted by therapy with HRP-conjugated secondary antibodies at room temperature for 1.5 h. An Omni-ECL Pico Mild Chemiluminescence Equipment (EpiZyme, SQ201) was utilized to establish protein bands, in addition to a ChemiDoc system (Bio-Rad) was employed to show the outcomes. Utilizing Picture Lab software program from Bio-Rad, bands have been analyzed. The next proteins have been focused by the principle antibodies (1:1,000) within the research: iNOS (Cell Signaling Know-how, cat# 13,120 S), Arg1 (Cell Signaling Know-how, cat# 93,668 S) and β-actin (Abcam, cat# ab213262).

Random-pattern pores and skin flap mannequin

Mouse random-pattern pores and skin flap mannequin was finished as beforehand described [12]. The C57BL/6 mice have been anesthetized by way of intraperitoneal injection with a 1% (w/v) resolution of sodium pentobarbital. Afterward, utilizing an electrical shaver and depilatory cream, the fur from the again of the anesthetized mannequin mouse with a randomly-pattern flap was shaved. Underneath sterile circumstances, sterile devices have been used to carry the caudal pores and skin/sarcoma flap (dimensions: 1.5 × 4.5 cm2) below the dorsal fascia of the mouse. Subsequently, the sacral arteries that offered blood provide to the flap have been surgically excised, together with each the left and proper sides. The mice within the PBS group, 2D-ABs group, and 3D-ABs group obtained subcutaneous injections of 100 µl (administered at 8 injection websites) containing PBS and ABs (at concentrations of 0.5, 1, or 1.5 mg/ml) utilizing a microinjection needle alongside the fast extension axis. Ultimately, 4 − 0 nonabsorbable silk sutures have been used to stitch the cut up flap straight into the donor mattress. To forestall postoperative an infection, eradicate the odor of blood from the wound, and deter any biting, the wound was disinfected with 1% iodophor twice each day following the surgical procedure.

We randomly categorized the C57BL/6J mice into 7 therapy teams (mg/ml): the PBS (n = 6), 0.5-2DABs (n = 6), 1-2DABs (n = 6), 1.5-2DABs (n = 6), 0.5-3DABs (n = 6), DiI-2D-ABs (n = 5) and DiI-3D-ABs (n = 5) teams. All mice have been tagged with ear tags and positioned randomly, with 5 mice per cage, maintained below appropriate temperature and humidity circumstances with entry to ample meals and water. The pores and skin flap was evenly divided into three zones, from proximal to distal, particularly zone I, zone II, and zone III. Zone II is the place our subsequent experimental was carried out.

Internalization of ABs into ECs and microphages in vivo

Following the strategy talked about above, 0.5 mg/ml DiI-ABs have been employed for in situ injection into the pores and skin flap on POD3, a zone II pores and skin flap was obtained for frozen part staining. ECs and macrophages have been recognized utilizing CD31 (Servicebio, GB11063-2-100) and CD68(Santa Cruz Biotechnology, sc-20,060), respectively. Main antibodies have been left to incubate in a single day in a fridge set at 4 °C. The next day, after being washed thrice with PBS, secondary antibodies (goat anti-rabbit IgG – H&L DyLight® 488; goat anti-mouse IgG – H&L DyLight® 594) have been added, and the samples have been incubated for one hour at 37 °C in a water tub. DAPI was used to stain the cell nuclei, and the statement of ABs’ phagocytosis by endothelial cells and macrophages throughout the flap was performed utilizing a confocal microscope.

Infrared thermal imaging scan

Thermal pictures of the ischaemic flaps have been captured utilizing the FLIR One Professional (FLIR Methods, Inc. USA) exterior probe for infrared thermal imaging by way of a cell phone. Common temperatures of the working space and the top and neck space have been measured independently (regular pores and skin). Delta-T, outlined because the temperature distinction between the working space and regular pores and skin, was decided. Temperature variations between the teams have been analyzed and in contrast. The basal physique temperatures of mice in every group remained throughout the regular vary. A better method to a delta-T of 0 °C indicated higher flap restoration.

Laser doppler blood circulation (LBDF)

The vascular community of the flap was visualized utilizing LDBF evaluation. After anesthesia on POD7, the mouse was maintained in a disturbance-free atmosphere. Subsequently, a laser Doppler instrument was employed to guage the pores and skin flap’s blood provide. The LDBF evaluation was performed following established procedures. The moorLDI Assessment software program (ver. 6.1; Moor Devices) was utilized to calculate perfusion items (PUs) for the evaluation of blood circulation. Three measurements of every mouse’s blood circulation have been made, and statistical evaluation was carried out on the typical outcome.

Immunohistochemistry

The mouse flap tissue in zone II was fastened utilizing 4% paraformaldehyde. After paraffin embedding, the flap tissue from space II was sectioned into 4-µm sections. In each IF experiment, xylene was used to deparaffinize the sections. After the tissue had been deparaffinized, it was rehydrated and put via a sodium citrate buffer antigen retrieval process. Following this, in PBS containing 0.1% Triton X-100, 10% goat serum was used to dam the sections. After that, they have been incubated for one hour the following day at room temperature with secondary antibodies and all through the whole night time with main antibodies at 4 °C. DAPI was used to stain the cell nuclei. The first antibodies utilized have been particular to CD31 (1:200), CD68 (1:200), α-SMA (1:200; Proteintech, 67735-1-Ig), iNOS (1:200), and Arg1 (1:200). Goat polyclonal secondary antibody in opposition to rabbit IgG – H&L DyLight-488, goat anti-mouse IgG – H&L DyLight-488 (Abcam, ab96871), goat anti-rabbit IgG – H&L DyLight-594 (Abcam, ab96885), and goat anti-mouse IgG – H&L DyLight-594 have been among the many secondary antibodies.

For TUNEL assays on frozen pores and skin sections, we used an in situ cell loss of life detection package in keeping with the producer’s directions. Dihydroethidium (DHE) staining was carried out on frozen pores and skin sections as per the producer’s protocol to detect collagen injury. F-CHP (3Helix Inc., FLU300) was utilized in keeping with the producer’s protocol.

RNA isolation and library preparation

Whole RNA was extracted as beforehand described. With the intention to generate small RNA libraries, 1 µg of whole RNA from each pattern was ready utilizing the NEBNext Small RNA Library Prep Set for Illumina package (Cat. No. NEB#E7330S, NEB, USA) in accordance with the directions offered by the producer. To summarize, each ends of the overall RNA have been ligated to adapters, after which reverse transcription to cDNA and PCR amplification have been carried out. Small RNA libraries have been produced by isolating and purifying PCR merchandise with a bp vary of 140–160. The Agilent Bioanalyzer 2100 system was used to evaluate the standard of the library.

The Illumina Novaseq 6000 platform was used for sequencing, producing 150 bp paired-end reads. OE Biotech Co., Ltd. performed small RNA sequencing and evaluation (Shanghai, China).

MiR-seq

Base calling was used on the unique readings to be able to produce sequence information, also referred to as uncooked information/reads. Subsequently, low-quality readings have been filtered out and reads containing poly (A) and 5’ primer contamination have been eliminated. To amass clear reads, additional filtering was carried out on reads from the uncooked information that didn’t embody a 3’ adapter, insert tag, or that have been longer than 41 nt or lower than 15 nt. The size distribution of the clear sequences within the reference genome was decided, then the sequences have been aligned and subjected to the Bowtie [69] search in opposition to Rfam v.10.1 (http://www.sanger.ac.uk/software program/Rfam) [70], rRNA, scRNA, Cis-reg, snRNA, tRNA and different RNAs have been annotated and filtered. Then, cDNA sequence and Repbase [71] database of species repeat sequence have been additionally recognized with Bowtie software program. The mature miRNAs have been recognized by aligning in opposition to miRBase v22 database (http://www.mirbase.org/) [72], and the expression patterns in several samples have been analyzed.

miRNAs that have been differentially expressed have been decided and filtered utilizing a threshold of FC > 2 and q worth < 0.05. For experiments with organic replicates, the DEG methodology within the R package deal was used to find out the q worth; for experiments with out organic replicates, the Audic Claverie statistic was used. The targets of differentially expressed miRNAs have been predicted through the use of software program miranda in animal, with the parameter as follows: S ≥ 150, ΔG ≤ − 30 kcal/mol and demand strict 5’ seed pairing.

R was utilized to conduct GO enrichment and KEGG pathway enrichment evaluation of distinct expressed miRNA-target genes, respectively, using the hypergeometric distribution.

Statistics

Statistical assays have been accomplished by way of the SPSS 22 programme (USA). All information are described as the typical ± SEM. The entire information displayed right here have undergone normalization to account for unintended sources of variance. To seek out variations between 3, 4, or 5 teams, an ANOVA was used, adopted by LSD (equal variances assumed) put up hoc analyses or Dunnett’s T3 (equal variances not assumed). The research employed independent-specimen t checks to establish group variations. P < 0.05 indicated statistical significance.

Related Articles

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Latest Articles