[HTML payload içeriği buraya]
29.5 C
Jakarta
Wednesday, July 22, 2026

M cells focused H. pylori antigen SAM-FAdE displayed on bacterium-like particles induce protecting immunity | Journal of Nanobiotechnology


Strains and mouse

Escherichia coli DE3 and L. lactis NZ9000 are maintained on this laboratory. E. coli DE3 was routinely cultured in Luria-Bertani (LB) medium at 37 °C, whereas NZ9000 was amplified and cultured in M17 medium supplemented with 0.5% glucose at 30 °C. H. pylori SS1 was cultured on 90 mm Columbia blood agar plate containing H. pylori additive (HB8646a, Qingdao Haibo) beneath microaerobic circumstances for two–3 days. The BALB/c male mice used within the experiments, aged 5–6 weeks, have been bought from Beijing Huafukang Biotechnology, and housed in a SPF experimental animal heart. They have been supplied with a typical weight loss program and consuming water. After one week of acclimatization, the related experiments have been carried out.

Preparation of BLPs-SAM-FAdE

To acquire BLPs, we first washed the precipitated L. lactis obtained from amplification tradition with sterile water, then re-suspended them in 0.1 M HCl and heated at 100 °C for 30 min to kind the precipitate. Afterward, we washed the precipitate 3 times with sterile PBS and re-suspended it, adjusting the BLPs focus to 1 U/mL for later use. To acquire the M cell-targeting recombinant protein SAM-FAdE, we first amplified the E. coli DE3 containing the pCZN1-SAM-FAdE plasmid, and when the OD600 reached 0.6–0.8, we induced expression for 4 h utilizing 0.2 mM IPTG, adopted by purification of the recombinant protein SAM-FAdE utilizing a Ni column. To organize the particle vaccine BLPs-SAM-FAdE, we blended 1 U of BLPs with 80 µg of purified antigen SAM-FAdE at room temperature for two h, after which washed to take away unbound antigen.

SDS-PAGE and Western blot

Acquire the bacterial cells after amplification and induction, the supernatant after ultrasonic disruption, and the bacterial cells for SAS-PAGE evaluation of protein expression. Then, use the AKTA protein purification system (GE Healthcare, USA) to acquire SAM-FAdE. The focus of the recombinant proteins SAM-FAdE is decided utilizing a BCA protein assay package and protein densitometry evaluation. Briefly, the obtained samples are blended with loading buffer and denatured at 98 °C for 10 min. The proteins are then subjected to vertical electrophoresis at a relentless present of 150 V for 1 h (Bio-Rad, USA). After staining with Bradford, the gel is decolorized till clear bands are seen. For Western blotting, the steps embody membrane switch, blocking, incubation with anti-His (Proteintech, China), and incubation with the secondary antibody. Lastly, protein bands are analyzed utilizing an publicity system.

Attribute evaluation of BLPs

To acquire certified BLPs for the preparation of particulate vaccines, the morphology adjustments of the NZ9000, BLPs, and BLPs-SAM-FAdE have been noticed utilizing a transmission electron microscope (HT7800, Japan). In the meantime, the samples have been diluted and analyzed for adjustments in particle measurement utilizing a Malvern laser particle measurement analyzer (Mastersizer 2000, UK).

Binding of BLPs and purified antigens

Take 100 µL of BLPs and BLPs-SAM-FAdE respectively, incubate with FITC-labeled anti-His antibody for two h, then wash to gather the precipitate, re-suspend in 1 mL PBS and thru the movement cytometer (C6, USA) to investigate its fluorescent expression. As well as, we additionally analyzed the binding of BLPs to purified antigens by oblique immunofluorescence. BLPs and BLPs-SAM-FAdE have been evenly unfold on lysine-treated slides, air-dried, and blocked with 3% BSA-PBS for 30 min. After washing twice with PBS, the slides have been incubated with anti-FAdE mouse polyclonal antibody (1:100) ready in our laboratory for 60 min at room temperature. After washing 3 times with PBS, the slides have been incubated with FITC-labeled goat anti-mouse IgG (1:200, Proteintech, China) for 60 min at midnight. The slides have been washed 3 times with PBS, and fluorescence was noticed beneath a laser confocal microscope (ZEISS, Germany).

Building and verification of M cell mannequin

In response to the tactic of Kerneis et al. [22], the M cell mannequin was constructed utilizing co-culture of Caco-2 cells and Raji B cells. We added 5 × 105 Caco-2 cells to a 3 μm Transwell chamber, modified the medium each different day, and picked up the tradition medium within the higher chamber for later use till they have been totally differentiated (14 days). Subsequent, Raji B cells (105) have been added to the basolateral facet of the Transwell chamber and cultured for 4 days. On the similar time, no Raji B cells have been added as a management. Order to confirm whether or not the M cell mannequin was efficiently constructed [23], the membrane of the Transwell chamber was first noticed utilizing a scanning electron microscope (S-3400 N, Japan). On the similar time, the adjustments in ALP exercise on days 4, 8, 12, 14, 16, 18, and 20 have been analyzed utilizing an alkaline phosphatase (ALP) detection package (Beyotime, China).

After efficiently setting up the mannequin, we validated the M cell focusing on of BLPs-SAM-FAdE in vitro by including inexperienced fluorescently labeled BLPs-SAM-FAdE and BLPs to each mono-culture and co-culture methods and incubating them at midnight for six h. After washing, 1 mL of 4% paraformaldehyde was added to fixation, and focusing on was noticed utilizing a fluorescence microscope (OLYMPUS, Japan). Moreover, we validated the focusing on of the particulate vaccine in vivo utilizing an ileal loop experiment. After totally cleansing a phase of the mouse ileum, one finish was tightly tied off, and BLPs-SAM-FAdE and FAdE have been individually infused from the opposite finish earlier than being sealed. After a 6-hour response, the tissue was frozen and sectioned. BLPs-SAM-FAdE and FAdE have been recognized utilizing Alexa Fluor®647-labeled anti-His antibodies, whereas FITC-labeled GP2 antibodies have been used to establish PPs M cells. Lastly, the fluorescent indicators have been noticed utilizing a confocal microscope (ZEISS, Germany).

Lastly, we analyzed the organic distribution of the BLPs-SAM-FAdE vaccine utilizing in vivo imaging system (IVIS). Six-week-old BALB/c mice have been fasted with water and meals for twenty-four h after which gavaged with particular volumes of AlexFluor®488-FAdE and AlexFluor®488-BLPs-SAM-FAdE, respectively. After 24 h of free motion, the mice have been euthanized, and the abdomen and intestinal tissues have been dissected individually to watch the fluorescence distribution utilizing IVIS (IVIS Lumina III, USA).

Immunization and pattern assortment

As proven in Fig. 1A, to judge the impact of BLPs-SAM-FAdE in clearing H. pylori, 24 male BALB/c mice aged 6–8 weeks have been randomly divided into 4 teams (6 mice per group). One group was given regular consuming water as a management (Management group), whereas the opposite three teams have been gavage with a H. pylori suspension (1 × 109 CFUs/mL) at 300 µL per mouse each different day, for a complete of 4 gavage periods to determine an H. pylori mouse an infection mannequin. To confirm the profitable development of the mannequin, we randomly took the abdomen tissues of two mice on the 4th week after the ultimate an infection, and used the speedy urease detection assay, H. pylori colony formation assay, and RT-qPCR to confirm whether or not the mice have been efficiently contaminated with H. pylori. One month after the gavage, the three teams of mice have been respectively gavage with PBS (H. pylori group), a mixture antibiotic therapy (metronidazole + amoxicillin + omeprazole, Antibiotics group), and BLPs-SAM-FAdE (1 U BLPs with 80 µg antigen, BLPs-SAM-FAdE group) as soon as per week, and the therapy was continued for 4 weeks. Ten days after the final immunization, the gastric tissues of the mice have been collected to judge the impact of H. pylori clearance.

Fig. 1
figure 1

(A) Schematic diagram of time factors of BLPs-SAM-FAdE therapy of H. pylori (Hp) an infection mannequin; (B) RT-qPCR detects expression of H. pylori 16S rRNA in gastric tissue; (C) H. pylori quantitative tradition statistical chart; (D) Abdomen statistical chart of gastritis rating of HE staining; (E) HE staining of gastric tissue (×200)

Moreover, to research the precise mechanism by which BLPs-SAM-FAdE induces an immune response, wholesome male BALB/c mice aged 6–8 weeks have been randomly divided into 4 teams and gavage with PBS, BLPs (1 U), the monovalent antigen SAM-FAdE (80 µg), and BLPs-SAM-FAdE (1 U BLPs with 80 µg antigen) as soon as per week for 4 consecutive weeks. Within the sixth week, gastrointestinal lavage fluid and feces have been collected to judge the manufacturing of antigen-specific sIgA. Blood was collected through the orbital vein to separate serum for detecting antigen-specific IgG and subtype. Moreover, spleens and lymph nodes have been collected to isolate lymphocytes for analyzing the activation of germinal facilities, plasma cells, and T cell responses induced by the BLPs-SAM-FAdE.

Skill of BLPs-SAM-FAdE to activate BMDCs in vitro

BMDCs have been obtained from the femurs and tibias of 8-week-old BALB/c mice and cultured in RPMI 1640 medium containing 5% FBS, 1% antibiotics, 20 ng/mL GM-CSF, and 20 ng/mL IL-4 for 7 days, with medium adjustments on days 3 and 6. To guage the induction functionality of BLPs-SAM-FAdE on BMDCs, the BMDCs have been seeded at a density of 1 × 105 cells per properly and co-cultured with BLPs, SAM-FAdE single antigen, and BLPs-SAM-FAdE for twenty-four h. BMDCs handled with LPS served as a constructive management, and untreated BMDCs served as a unfavorable management. Lastly, the cells have been collected and incubated with PE anti-mouse CD11c, FITC anti-mouse MHC II, APC anti-mouse CD40, Tremendous Vivid™ 436 anti-mouse CD80, and Tremendous Vivid™ 600 anti-mouse CD86 (Invitrogen) monoclonal antibodies for 40 min. The expression of floor markers or co-stimulatory molecules was detected utilizing movement cytometry. Moreover, the secretion of IL-1β, IL-12p70, IL-4, and IL-6 within the supernatant was measured utilizing an ELISA package (Fantastic Take a look at®, China) in keeping with the producer’s directions.

FAdE-specific IgG, IgG1, IgG2a and sIgA ELISA

In abstract, 100 µL of SAM-FAdE antigen coating answer was added to every properly of the ELISA plate at a remaining focus of two µg/mL and incubated in a single day at 4 °C. The subsequent day, the plate was washed twice and blocked with 5% BSA-PBS for two h, adopted by 4 washes earlier than including samples. Gradients of diluted serum or samples akin to gastrointestinal lavage fluid and feces have been added to the ELISA plate and incubated for 1 h, adopted by three washes and subsequent incubation with HRP-conjugated sheep anti-mouse IgG, IgG1, IgG2a, and sIgA (Abcam, USA) for 1 h. After incubation, the ELISA plate was washed 3–4 occasions and developed with 100 µL TMB for 30 min. Lastly, 50 µL of two M H2SO4 was added to cease the response, and the absorbance was measured at 450 nm.

FAdE-specific IFN-γ/IL-4/IL-17 T-cell

To evaluate the induction of FAdE-specific CD4+ T cell responses following oral immunization, splenocytes have been extracted from mice and stimulated with SAM-FAdE. The cells have been then collected for intracellular cytokine staining, utilizing the next antibodies: BV421-anti mouse CD3, FITC-anti mouse CD4, PE-anti mouse IFN-γ, Percp cy5.5-anti mouse IL-4, and APC-anti mouse IL-17A (Biolegend). Moreover, cytokine secretion ranges of IFN-γ, IL-4, and IL-17A within the supernatant have been measured utilizing an ELISA package (Fantastic Take a look at®, China). Moreover, we evaluated the activation ranges of Th1, Th2, and Th17 akin to the secretion of IFN-γ, IL-4, and IL-17A utilizing the ELISPOT assay in keeping with the producer’s directions (Mabtech).

GC B cell and plasma cell staining

The mesenteric lymph nodes (MLN) of mice have been immersed in sterile PBS, mechanically floor, and filtered by way of a 200-mesh filter to take away particles. The activation ratios of germinal heart B cells and plasma cells have been evaluated utilizing the next antibodies: FITC-anti mouse CD45R/B220 (Invitrogen), PE-anti mouse CD95 (Fas), APC-anti mouse GL-7, and BV421-anti mouse CD138 (Biolegend). Samples have been analyzed utilizing a FACS Celesta movement cytometer (BD, USA) and knowledge have been processed with FlowJo 10.8.1 software program. The activation standing of germinal facilities within the spleen was assessed by way of tissue immunofluorescence evaluation. Abdomen tissues from mice orally administered PBS, BLPs, SAM-FAdE, and BLPs-SAM-FAdE have been embedded, sectioned into 10 μm thick slices, mounted, and blocked, then stained with the next antibodies: BV510-anti mouse CD4 (BD Biosciences), FITC-anti mouse B220 (Invitrogen), and Rhodamine-PNA (Vector). After mounting, observations have been made utilizing a confocal microscope (ZEISS, Germany).

Results of BLPs-SAM-FAdE therapy on H. pylori an infection

10 days after the ultimate immunization, mouse gastric tissues have been remoted and divided into three elements: one half was used for quantitative tradition of H. pylori [24], one other for RT-qPCR detection of H. pylori-specific 16S rRNA expression, and the final half for histopathological evaluation. The primer sequences used have been as follows: H. pylori 16S rRNA (Ahead: CTCATTGCGAAGGCGACCT, Reverse: TCTAATCCTGTTTGCTCCCCA) and inner management 18S rRNA (Ahead: GCAATTATTCCCCATGAACG, Reverse: GGCCTCACTAAACCATCCAA). In response to quantitative tradition of H. pylori, the gastric tissue was homogenized in 0.5 mL of PBS. After diluting it within the following ratios: 1:10, 1:100, and 1:1000, 100 µL was plated onto 90 mm Columbia blood agar plate containing H. pylori additive beneath microaerobic circumstances for two–3 days previous to a colony rely being carried out. The colony-forming models per gram of abdomen tissue (CFU/g): H. pylori colonization density was equal to micro organism colony rely × dilution / gastric weight. For HE staining, gastric tissues have been mounted in 10% formaldehyde, dehydrated by way of a graded ethanol collection, embedded in paraffin, sectioned, and stained with hematoxylin-eosin for microscopic remark. The pathological scoring of gastric mucosal harm was based mostly on the next scoring standards Desk 1 [25].

Desk 1 Histological scoring standards

Statistical evaluation

Except in any other case specified, knowledge are proven because the imply ± SD and every experiment was repeated two or 3 times. Knowledge have been analyzed by the two-tailed unpaired t-test or one-way ANOVA with Tukey’s put up hoc evaluation utilizing GraphPad Prism.

Related Articles

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Latest Articles